gjimenez3827
gjimenez3827
29-01-2024
Computers and Technology
contestada
is chicken super good
Respuesta :
ajfeth012
ajfeth012
29-01-2024
Answer: Yes it is
Explanation:
Good protein and amazing taste!!
Answer Link
VER TODAS LAS RESPUESTAS ( 27+ )
Otras preguntas
When servicing a heating boiler and radiators, a plumber knows that the time he will take is given by the formula Time = 1 hour + 45 minutes per radiator He cha
- William Shakespeare, Macbeth, Act II, scene i What evidence leads you to believe that the dagger Macbeth sees is an illusion? O A. Is this a dagger which I se
You would like to establish a trust fund to provide $150,000 a year forever for your heirs. The expected rate of return is 4.3 percent. How much money must you
Why is important to know about the Appomattox Courthouse's location for the Civil War?
I accidentally ate an awful apple identify the alliteration or the sound that's being repeated that gives the alliteration.
There were 90 people at the party who each had 1 cup of juice. How many quarts of juice were used at the party? *
he income elasticity of demand for caviar tends to be a. high because caviar is relatively expensive. b. low because caviar is packaged in small containers. c.
The ratio of the Areas of the bases of these cones is 9 to 4. Find the ratio of the Volumes of the similar cones
Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU
Which statement best describes the setting of "By the Waters of Babylon”? The story is set in New York City during an apocalypse, in which people are trying to
