CecilliaY89443 CecilliaY89443

29-10-2022
Mathematics

contestada

At logging firm needs to cut a 51 -m- long redwood log into 20 equal piece before loading it onto a truck for shipment. How long will each piece be?Each piece will be ___m long

Respuesta :

AmerikaP225380 AmerikaP225380

29-10-2022

Divide 51 m by 20

so

51/20=2.55 m

therefore

the answer is

Each piece will be 2.55 m long

Answer Link

Otras preguntas

Megan is trying very hard not to get sick during this year's flu season. What would be the BEST advice you can give her on how not to get sick? a. Manage your w

how many days are there in 7 weeks

What multiplies to -216 but adds to 6

Which phrase describes the study of ecology? a. transfer of light energy to chemical energy b. organisms that reproduce and maintain structure c. comparing

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Morphology is the branch of grammar dealing with the forms of words. a. True b. False

How did President Truman’s Executive Order 9981 show progress toward racial equality?

would hair color be a single gene trait? why?

Kant argues that we should never use people as a means: unless we are certain that doing so will lead to the greatest overall happiness. unless we can do so w

_____ can keep you alert and sharpen your concentration