The mRNA produced by the transcription of a gene encoding an oligopeptide is: 5 'AAAUGAAACCAGGAUAAGAAUU3' while the peptide produced by the translation of the above mRNA is: H2N-methionine-lysine-proline-glycine-COOH What is the anticodon of tRNA that will be placed in the ribosome after the cleavage of tRNA, which carries the amino acid lysine? Justify your answer.