flowerjess flowerjess

30-04-2021
Biology

contestada

Which measure would be MOST effective in increasing the human population's immunity against contagious diseases?

A. Getting vaccinated against contagious diseases
B. Treating the first person infected with the contagious disease
C. Isolating the first person infected with the contagious disease
D. Distributing antibiotics in the community to avoid the contagious disease

Respuesta :

kaisersriprad kaisersriprad

30-04-2021

Answer:

I think it's letter B

because if you treat the first affected person then you can ensure that the disease is not around and the community got rid of it.

Answer Link

Otras preguntas

Product mix is typically associated with which risk category?

What is the explicit formula for the arithmetic sequence –7.5, –9, –10.5, –12...

According to the picture above, who was most afraid of joining the League of Nations, and therefore, refusing to approve our entry into the organization

Which statement is true? HIV is the virus that causes AIDS; there is no cure for HIV. HIV is a bacterial infection that takes over the body's immune system. HIV

While aphorisms and epigrams both express a truth about life, an epigram takes the form of a narrative a poem an essay an argument

Consider the following mRNA strand: CCAUGGCAAAGGAGUGACUAA a. What DNA sequence would encode for this mRNA? Provide the sequence in form (single-or doublestrand

What is the name of the device that sense the current flowing

Read this excerpt from Margaret Frink's memoir: At last Robert and I got to the top with the mules and their burdens. I was utterly exhausted. I took a buffalo

why does the narrator say that "the beating of the old man's heart...increased[his] fury as the beating of a drum stimulates the solider into courage?"

Rank these reactions from least to most energetically favorable. 1. Glucose to Glucose-6-P, +3.3kcal/mol 2. PEP to pyruvate, -14.8kcal/mol 3. ATP to ADP and Pi,