softiebunny839 softiebunny839

27-01-2021
Mathematics

contestada

Coefficient What is the coefficient in the equations 8 = 2y + 3

Respuesta :

ilove2study ilove2study

27-01-2021

2 is the coefficient. Y is 2.5

Answer Link

Otras preguntas

given the points (0,-1) and (-6,-7) and on a line, find its equation in the form y= mx+b y=_______

MAMD.M.D. 1B: A dormitory on campushouses 200 students. 120 are male, 50are upper division students, and 40 areupper division male students. A studentis selecte

A car starts from rest and accelerates uniformly overtime of 5.21 seconds for a distance of 110 m. Determine the acceleration of the car in m/s^2

Solutions are found in many different places on earth, but one of the most common in our lives is soft drinks. Explain how a soft drink (you may pick one or ta

an individual may not process stimuli that are in some way threatening, or may distort the meaning of a stimulus to make it less threatening. this type of perce

wyjaśnij rolę postaci Jadwigi i Jagiełły w dziejach Polski. Jak najszybciej, Dzięki :)

Production Écrite Normalement,tu aurais dû être à l’école à cette période de l’année dis ce que tu ressens face à cette situation chaotique et quels conseils do

You can use a table to find a constant rate of change a) The table shows the amount of money a booster club makes washing cars for a fundraiser. Use the informa

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts): Amino ac

Mason read a total of 12 books over 4months. After belonging to the book club for 5 months, how many books would mason have read in all?