dhmyronnick00 dhmyronnick00

30-10-2020
Mathematics

contestada

Find the missing angle for 25 and 31

Respuesta :

markjonathan06p78e60 markjonathan06p78e60

01-11-2020

Answer:

it should be 180-31-25=124°

Answer Link

Otras preguntas

Ángela has written the birthdays of five Spanish Club members in her agenda. Choose the correct date for the sentence in Spanish to give the day or date of the

What voltage is needed to cause a 5A current flow through a 2Ω resistor?

Maya's roof was leaking so she borrowed $12,000 from the bank for repairs it is a five-year loan and she's being charged simple annual interest at a rate of 7.5

Given the function f(x) = x3 − 18x2 + 107x − 210, what are the y-intercept and x-intercepts? Show the work steps to find these intercepts

A compound is formed by the reaction of nitrogen with oxygen gas. Can you predict the formula of the compound formed? Explain.

How do you figure out mechanical energy

What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT

Your auto insurance policy has a 200 monthly premium and 700

Which of the following options best completes this sentence? _____________ is the ratio of the effective output to the total input in any system; producing the

How do memeber of a traditional economy trade goods?